View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7740_high_1 (Length: 455)
Name: NF7740_high_1
Description: NF7740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7740_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 178 - 442
Target Start/End: Original strand, 37196620 - 37196884
Alignment:
| Q |
178 |
tatctatcaaatttgttgggtccaaaaatacacatttcctcactcaaatggcctctgtacgtttgtttttgttagctattttgatcattgtctcactttc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37196620 |
tatctatcaaatttgttgggtccaaaaatacacatttcctcactcaaatggcctctgtccgtttgtttttgttagctattttgatcattgtgtcactttc |
37196719 |
T |
|
| Q |
278 |
cagcattgacaatgtccaaggtggtgggactagaaaacttttgacacaaacatttcctgatttgggcaaaattccagggctagagtttcctcctttccca |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37196720 |
cagcattgacaatgtccaaggtggtgggactagaaaacttttgacacaaacatttcctgatttgggcaaaattccagggctagagtttcctcctttccca |
37196819 |
T |
|
| Q |
378 |
ccagtgactgaatggccagagtacaggttgcctccacccattttcaatattcctgacttcttctc |
442 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37196820 |
ccagtgactgaatggccagagtacaggttgcctccacccattttcaatattcctgacttcttctc |
37196884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 145; E-Value: 4e-76
Query Start/End: Original strand, 14 - 186
Target Start/End: Original strand, 37196431 - 37196598
Alignment:
| Q |
14 |
caattaactctatgtacgaattaagcattatattgttgtgaagaatattcaaatatttctctttgaattaactcatgtacgaatatggtttaagttgtac |
113 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37196431 |
caattaactccatgtacgaattaagcatt-----gttgtgaagaatattcaaatatttctctttgaattaactcatgtacgaatatggtttaagttgtac |
37196525 |
T |
|
| Q |
114 |
tataaaaacacaagaaccaactcttatgttgtcacttgtcttcactcttctcccttactgcaattatctatca |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37196526 |
tataaaaacacaagaaccaactcttatgttgtcacttgtcttcactcttctcccttactacaattatctatca |
37196598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University