View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7741_high_39 (Length: 329)
Name: NF7741_high_39
Description: NF7741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7741_high_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 15 - 311
Target Start/End: Complemental strand, 9829647 - 9829351
Alignment:
| Q |
15 |
tttggtggtcgcgatcacatattgcaatctgtttattagtcaaaagaattagctttttgttttataaaaatcaactaacatattgaagggtgaatatctt |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9829647 |
tttggtggtcacgatcacatattgcaatctgtttattagtgaaaagaattagctttttgttttataaaaatcaactaacatattgaagggggaatatctt |
9829548 |
T |
 |
| Q |
115 |
aagggagggtgaatannnnnnnagggaatttttaaccactaatcaacttgnnnnnnnttaaactccatgataatgagccaattagccggttgttttacga |
214 |
Q |
| |
|
|||| ||||||| || |||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9829547 |
aaggaagggtgagtatttttttagggaatttttaaccattaatcaacttgaaaaaaattaaactccatgataatgagccaattagctggttgttttacga |
9829448 |
T |
 |
| Q |
215 |
cttaattcaactacaagtggagagagacactcgggaagtttttagtgtgaaccgttagaggatatactcattttaaagatggccctatagtatagta |
311 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||| ||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9829447 |
cttaattcaactacaagtacagagagagactcggaaagttttcagtgtgaaccgttagaggatatactcatttgaaagatggccctatagtatagta |
9829351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University