View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7741_high_43 (Length: 308)
Name: NF7741_high_43
Description: NF7741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7741_high_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 3569309 - 3569381
Alignment:
| Q |
1 |
ttgtttgatttgatgaaaatcaaagccttgcttccatggactcatgccaaaagtttaacaggaattgttgcca |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3569309 |
ttgtttgatttgatgaaaatcaaagccttgcttccatggactcatgccaaaagtttaacaggaattgttgcca |
3569381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 156 - 304
Target Start/End: Original strand, 3569471 - 3569623
Alignment:
| Q |
156 |
ataaattttgagcttggcggcat-----ggaggtttcgcgggataccaacctagttggaataccgttgtttcctcttgatgtacgtcctttctcttggct |
250 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||| ||||||||||| |||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3569471 |
ataaattttgagcttggcggcataggatggaggtttcgtgggatgccaacctagttagaatgccgttgtttcctcttgatgtccgtcctttctcttggct |
3569570 |
T |
|
| Q |
251 |
taccnnnnnnnnnnnnngtcattggcacatcgacagggacaattcttctcactc |
304 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3569571 |
tacc-aaaaaaaaaaaagtcattggcacatcgacagggacaattcttttcactc |
3569623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 196 - 244
Target Start/End: Complemental strand, 10972653 - 10972605
Alignment:
| Q |
196 |
ccaacctagttggaataccgttgtttcctcttgatgtacgtcctttctc |
244 |
Q |
| |
|
||||||||||||| || |||||||||| ||||||||| |||||||||| |
|
|
| T |
10972653 |
ccaacctagttgggatgccgttgtttcttcttgatgtttgtcctttctc |
10972605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 252
Target Start/End: Original strand, 9344496 - 9344570
Alignment:
| Q |
178 |
tggaggtttcgcgggataccaacctagttggaataccgttgtttcctcttgatgtacgtcctttctcttggctta |
252 |
Q |
| |
|
||||||||| |||| | ||||||||||||| || |||||||| ||||||||||| ||| |||||| ||||||| |
|
|
| T |
9344496 |
tggaggttttgcggagtgccaacctagttgggatgtcgttgttttctcttgatgtatgtcatttctcctggctta |
9344570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 231
Target Start/End: Complemental strand, 2259458 - 2259404
Alignment:
| Q |
177 |
atggaggtttcgcgggataccaacctagttggaataccgttgtttcctcttgatg |
231 |
Q |
| |
|
||||||||||| |||||| ||||||||||||| || || ||||||||||||||| |
|
|
| T |
2259458 |
atggaggtttcccgggatgccaacctagttgggatgtcggtgtttcctcttgatg |
2259404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University