View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7741_high_57 (Length: 227)
Name: NF7741_high_57
Description: NF7741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7741_high_57 |
 |  |
|
| [»] scaffold1221 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1221 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: scaffold1221
Description:
Target: scaffold1221; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 19 - 216
Target Start/End: Complemental strand, 1435 - 1239
Alignment:
| Q |
19 |
tcaccttctctagataagttttatagttctcaccttaagaacatatggttaagttagatgtcttcttcactttggatttttgttgtactataatatggtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1435 |
tcaccttctctagataagttttatagttctcaccttgagaacatatggttaagttagatgtcttcttcactttggatttttgttgtactataatatggtt |
1336 |
T |
 |
| Q |
119 |
gggttttcgtttgggtgttgaaggggtttatgatctgaaccatatactgctcttattttcaacctcatttttgtataaatcacaaatttccatattct |
216 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |||| |
|
|
| T |
1335 |
gtgttttcgtttgggtgttgaaggggtttatgatctgaaccatatactgctcttattttcaaactc-tttttgtataaatcacaaatttccattttct |
1239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 167 - 216
Target Start/End: Complemental strand, 14566716 - 14566667
Alignment:
| Q |
167 |
gctcttattttcaacctcatttttgtataaatcacaaatttccatattct |
216 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
14566716 |
gctcttattttcaaactcatttttgtataaatcacaaatttccattttct |
14566667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University