View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7741_high_60 (Length: 218)
Name: NF7741_high_60
Description: NF7741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7741_high_60 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 30836995 - 30836813
Alignment:
| Q |
1 |
tgaatggaaacaaaatgttaaaacagacaaaattcgaagtagggagaggatgattgatgacctctagtcctccatattacatatgtcaaatcgatcaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30836995 |
tgaatggaaacaaaatgttaaaacagacaaaattcgaagtagggagaggatgattgatgacctctagtcctccatattacatatgtcaaatctatcaaga |
30836896 |
T |
|
| Q |
101 |
ttcaaacaaaatattttctatgtttaaaacaattgatgcggtgggacttgatcgatccaaacaaatttcatgcggtttgcattctataaataggtttaat |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30836895 |
ttcaaac------------------aaaacaattgatgcggtgggacttgatcgatccaaacaaatttcatgcggtttgcattctataaataggtttaat |
30836814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University