View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7741_high_62 (Length: 216)
Name: NF7741_high_62
Description: NF7741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7741_high_62 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 20 - 197
Target Start/End: Complemental strand, 37210334 - 37210168
Alignment:
| Q |
20 |
attgaaacaaaatgaaatgaaatcaaagataaagataaaggtaataaattcttttccatttttgggtatgtttagcatgtggtccattccctccnnnnnn |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37210334 |
attgaaacaaaatgaaatgaaatcaaagataaagataa------taaattcttttccatttttgggtatgtttagcatgtggtccattccctccttttt- |
37210242 |
T |
 |
| Q |
120 |
nnnctttctgtatttggttacaaatacaacctttgcaacggtctcacccacccaacacgcaaactccttcatagtaca |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37210241 |
----tttctgtatttggttacaaatacaacctttgcaacggtctcacccacccaacacgcatactccttcatagtaca |
37210168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 71 - 111
Target Start/End: Complemental strand, 40556809 - 40556769
Alignment:
| Q |
71 |
ttttccatttttgggtatgtttagcatgtggtccattccct |
111 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40556809 |
ttttccatttttgggtatgtttaacatgtggtccattccct |
40556769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University