View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7741_low_27 (Length: 405)
Name: NF7741_low_27
Description: NF7741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7741_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 193 - 397
Target Start/End: Complemental strand, 33160655 - 33160451
Alignment:
| Q |
193 |
gacaccggatacacatttaatcggttggtgctgcataagtccaattgattgaaatgatgcaaagctatgtagcaatgacattgcgtattgaaggcatgtt |
292 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33160655 |
gacaccggatgcacatttaatcggttggtgctgcataagtccaattgattgaaatgatgcaaagctatgtagcaatgacattgcgtattgaaggcatgtt |
33160556 |
T |
|
| Q |
293 |
tggtgtccgacacgagactgacgcatgtggatacattcaaaggatttattttctcaaaatattatcggtgtcgatgtgttagagttgtgtccaccgttct |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33160555 |
tggtgtccgacacgagactgacgcatgtggctacattcaaaggatttattttctcaaaatattatcggtgtcgatgcgttagagttgtgtccaccgttct |
33160456 |
T |
|
| Q |
393 |
ctgct |
397 |
Q |
| |
|
||||| |
|
|
| T |
33160455 |
ctgct |
33160451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 19 - 107
Target Start/End: Complemental strand, 33160823 - 33160735
Alignment:
| Q |
19 |
tttgggccatgtaaatttcttttctaattcatttgggttttgtttctaggttttctactaacacaaacaccggacacgacacatagata |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33160823 |
tttgggccatgtaaatttcttttctaattcatttgggttttgtttctaggttttctactaacacaaacaccggacacgacacatagata |
33160735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 340 - 377
Target Start/End: Original strand, 25635129 - 25635166
Alignment:
| Q |
340 |
attttctcaaaatattatcggtgtcgatgtgttagagt |
377 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
25635129 |
attttatcaaaatattatcggtgtcgatatgttagagt |
25635166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University