View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7741_low_39 (Length: 345)
Name: NF7741_low_39
Description: NF7741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7741_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 335
Target Start/End: Complemental strand, 10271454 - 10271101
Alignment:
| Q |
1 |
tagtttagatatgttggtgtgacataatctctctataattcttttgaccttttg-------aaaaaatattttaagcgactttgatctccataatgcttg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10271454 |
tagtttagatatgttggtgtgacataatctctctataattcttttgaccttttgtcttttgaaaaaatattttaagcgactttgatctccataatgcttg |
10271355 |
T |
 |
| Q |
94 |
tgattgctcatatttctttgtttggggtcatcttcatttgtttttcaaatcacatgtttatggcaattgatatttctgttgttaaacaaattgatccaaa |
193 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10271354 |
tgattgcccatatttctttgtttggggtcatcttcatttgtttttcaaatcacatgtttatggcaattgatatttctgttgttaaacaaattgatccaaa |
10271255 |
T |
 |
| Q |
194 |
actttcaaagctttcatctta------------tgcataactttgaccatatttgagtaacagacactcaccaaactatcattagtttatttacaaaaca |
281 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10271254 |
actttcaaagctttcatcttatattctttctcgtgcataactttgaccatatttgaataacagacactcaccaaactatcattagtttatttacaaaaca |
10271155 |
T |
 |
| Q |
282 |
aaaggggtgtaaccttggataacggatgattacatttacactatgtttgatgtc |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10271154 |
aaaggggtgtaaccttggataacggatgattacatttacactatgttttatgtc |
10271101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University