View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7741_low_40 (Length: 345)
Name: NF7741_low_40
Description: NF7741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7741_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 9e-61; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 173 - 339
Target Start/End: Original strand, 17915129 - 17915295
Alignment:
| Q |
173 |
ttaggactgctaaagattctgccttacacagtgatatagaaggagactcctccattccaaagatagagcttcattctacaacgacgagttccttcaatga |
272 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||| ||||||||||||||||||||||| || |||||||| |||||||||| ||||||||||| |
|
|
| T |
17915129 |
ttaggactgctaaagattctgccttacataatgatatagagagagactcctccattccaaagataaagtttcattcttcaacgacgagatccttcaatga |
17915228 |
T |
 |
| Q |
273 |
aacatcgttgaatagcaatgttttgctcgatgacaccgcatcaacttcttccacctgcaacaccaaa |
339 |
Q |
| |
|
| |||||||||||||||||| ||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
17915229 |
agcatcgttgaatagcaatgctttgctccatgacaccgcatcaacttcttccaactgcaacaccaaa |
17915295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 54 - 175
Target Start/End: Complemental strand, 17975641 - 17975520
Alignment:
| Q |
54 |
ataggttaattgggatgaacataaagccttgcaggttctagagcgagtcagtccgtgggaggttgagattatttccaacatacatccactgcatcgacag |
153 |
Q |
| |
|
||||||||| |||||||||| ||||| || |||||||| ||||||||||||||| ||||||||||| | ||||||| ||||| | ||||||||| ||| |
|
|
| T |
17975641 |
ataggttaaatgggatgaacctaaagtctcgcaggttccagagcgagtcagtccttgggaggttgaaactatttccgacatatttgcactgcatccacaa |
17975542 |
T |
 |
| Q |
154 |
ttccctcgaacaaaaaagctta |
175 |
Q |
| |
|
|||| | ||||||||||||| |
|
|
| T |
17975541 |
ttccacccgacaaaaaagctta |
17975520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 18 - 61
Target Start/End: Original strand, 17915088 - 17915131
Alignment:
| Q |
18 |
atcttaaacattaatgtcatttttcatctcaacgtgataggtta |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17915088 |
atcttaaacattaatgtcatttttcatctcaacgtgataggtta |
17915131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University