View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7741_low_42 (Length: 338)
Name: NF7741_low_42
Description: NF7741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7741_low_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 318
Target Start/End: Original strand, 35548369 - 35548686
Alignment:
| Q |
1 |
tccaactatatttctgaaagcgtgtgaactattggatgtaaaacctgaggatgctgttcatgttggggatgatcgtcgaaatgatatatggggtgccaga |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35548369 |
tccaactatatttctgaaagcatgtgaactattggatgtaaaacctgaggatgctgttcatgttggggatgatcgtcgaaatgatatatggggtgccaga |
35548468 |
T |
|
| Q |
101 |
gatgcaggctgtgatgcatggctttggggaagtgatgttcactcttttaaggaggtatgttaagcatattcatctctttttgatgcataagaaaatttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35548469 |
gatgcaggctgtgatgcatggctttggggaagtgatgttcactcttttaaggaggtatgttaagcatattcatctctttttgatgcataagaaaatttta |
35548568 |
T |
|
| Q |
201 |
ctggagagtggagactagagggtgagtacacctaggggagnnnnnnncatcttcccaaaaatgattcttatgtaggtacctcccatattcaggttcttac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35548569 |
ctggagagtggagactagagggtgagtacacctaggggagaaaaaaacatcttcctaaaaatgattcttatgtaggtacctcccatattcaggttcttac |
35548668 |
T |
|
| Q |
301 |
tgctgggtgagagtttca |
318 |
Q |
| |
|
||||||||| |||||||| |
|
|
| T |
35548669 |
tgctgggtgggagtttca |
35548686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University