View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7741_low_53 (Length: 305)
Name: NF7741_low_53
Description: NF7741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7741_low_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 19 - 288
Target Start/End: Original strand, 28014378 - 28014647
Alignment:
| Q |
19 |
attgattcatctgccaatacatgtccgtgtataaaattgcttgcattcgcatttttaaaattacatttgaatgtgcaagaaaataacatgaagaaagaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
28014378 |
attgattcatctgccaatacatgtccgtgtataaaattgcttgcattcgcattttttaaattacatttgaatgtgcaagaaaataacatcaagaaagacc |
28014477 |
T |
 |
| Q |
119 |
gtaaagttgttgacttattgtttcacaactggaggatttaatttcaaaattacacatactaaccaatattcatttgcattttaactaaaagtttgcaaac |
218 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
28014478 |
gtaaagctgttgacttattgtttcacaactgaaggatttaatttcaaaattacacatactaaccaatattcatttgcattttaactgaaagtttgcacac |
28014577 |
T |
 |
| Q |
219 |
cccgattcaaaagaatctcactctcatctaaggattcactcaccnnnnnnnccttctaatttcctagtat |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28014578 |
cccgattcaaaagaatctcactctcatctaaggattcactcacctttttttccttctaatttcctagtat |
28014647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University