View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7741_low_62 (Length: 247)
Name: NF7741_low_62
Description: NF7741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7741_low_62 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 17 - 165
Target Start/End: Complemental strand, 41637902 - 41637754
Alignment:
| Q |
17 |
atattaaataaactccaattctatacacatagtaatcagccaacgaataaacaagatacaatttgatatttttgtcaaatcaaacaagcttaacccacca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41637902 |
atattaaataaactccaattctatacacatagtaatcagccaacgaataaacaagatacaatttgatatttttgtcaaatcaaacaagcttaacccacca |
41637803 |
T |
 |
| Q |
117 |
gtgatgtagtcgccttcatgcggacggaagacatatacactctacatgt |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41637802 |
gtgatgtagtcgccttcatgcggacggaagacatatacactctacatgt |
41637754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 163 - 230
Target Start/End: Complemental strand, 41637593 - 41637526
Alignment:
| Q |
163 |
tgtggtgatgttatgtgttgttagaccattgttttactttgtagcggccaccatggccacaaaagtag |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41637593 |
tgtggtgatgttatgtgttgttagaccattgttttactttgtagcggccaccatggccacaaaagtag |
41637526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University