View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7741_low_67 (Length: 239)
Name: NF7741_low_67
Description: NF7741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7741_low_67 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 26 - 221
Target Start/End: Original strand, 36130032 - 36130228
Alignment:
| Q |
26 |
gttatgcaaatagaaagtattcaccaccaaactcagagaacataaagaagaaaaatacaagagaattgttaatttcgctttacgcaatgtgctttca-tg |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |
|
|
| T |
36130032 |
gttatgcaaatagaaagtattcaccaccaaaatcagagaacataaagaagaaaaatacaagagaattgttaatttcgctttacgcaacgtgctttcaatg |
36130131 |
T |
 |
| Q |
125 |
ggcttgatttgttgggcttttgtggttataaggctattttaatgggctaagcccaacaagcttgtgaaaaagctcgaatgtttctttttaggcccct |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36130132 |
ggcttgattttttgggcttttgtggttataaggctattttaatgggctaagcccaacaagcttgtgaaaaacctcgaatgtttctttttaggcccct |
36130228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University