View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7741_low_71 (Length: 226)
Name: NF7741_low_71
Description: NF7741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7741_low_71 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 47288410 - 47288206
Alignment:
| Q |
19 |
cctccctacaaattccaactatttgtctgcgccacattgatcataaacaccctcaatccctaacacatccaccttccgccccatacctcaccactcacac |
118 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47288410 |
cctccccacaaattccaactatttgtctccgccacattgatcataaacaccctcaatccctaacacatccaccttccgccccatacctcatcactcacac |
47288311 |
T |
|
| Q |
119 |
ctttaagcgcaaactattatgatccacatacaacctctaacacccccttccctaaaaatgacaaattaaattctccgatcatgcgcacctcagaccacca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| ||| |
|
|
| T |
47288310 |
ctttaagcgcaaactattatgatccacatacaacctctaacacccccttccctaaaaatgacaaattaaattctccaatcatgcgcacctcaaacctcca |
47288211 |
T |
|
| Q |
219 |
aactc |
223 |
Q |
| |
|
||||| |
|
|
| T |
47288210 |
aactc |
47288206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University