View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7741_low_71 (Length: 226)

Name: NF7741_low_71
Description: NF7741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7741_low_71
NF7741_low_71
[»] chr3 (1 HSPs)
chr3 (19-223)||(47288206-47288410)


Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 47288410 - 47288206
Alignment:
19 cctccctacaaattccaactatttgtctgcgccacattgatcataaacaccctcaatccctaacacatccaccttccgccccatacctcaccactcacac 118  Q
    |||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
47288410 cctccccacaaattccaactatttgtctccgccacattgatcataaacaccctcaatccctaacacatccaccttccgccccatacctcatcactcacac 47288311  T
119 ctttaagcgcaaactattatgatccacatacaacctctaacacccccttccctaaaaatgacaaattaaattctccgatcatgcgcacctcagaccacca 218  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||    
47288310 ctttaagcgcaaactattatgatccacatacaacctctaacacccccttccctaaaaatgacaaattaaattctccaatcatgcgcacctcaaacctcca 47288211  T
219 aactc 223  Q
    |||||    
47288210 aactc 47288206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University