View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7741_low_79 (Length: 204)
Name: NF7741_low_79
Description: NF7741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7741_low_79 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 188
Target Start/End: Original strand, 25632616 - 25632785
Alignment:
| Q |
18 |
agaacaagacaaattggattatcataggtttcatgcatgggaggttattacgtgctttcactcaccaacattttcaatgtgaatcaacaattgcatgttc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25632616 |
agaacaagacaaattggattatcataggtttcatgcatgggaggt-attacgtgcttccactcaccaacattttcaatgtgaatcaacaattgcatgttc |
25632714 |
T |
 |
| Q |
118 |
ttactacaagccttttgctttggtgggatgggttgtaaaattgaatttaaattgagctcaatacaattcat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25632715 |
ttactacaagccttttgctttggtgggatgggttgtaaaattgaatttaaattgagctcaatataattcat |
25632785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 95 - 143
Target Start/End: Original strand, 25644073 - 25644121
Alignment:
| Q |
95 |
tgtgaatcaacaattgcatgttcttactacaagccttttgctttggtgg |
143 |
Q |
| |
|
|||| |||||||||||||||||||||||| || | ||||| |||||||| |
|
|
| T |
25644073 |
tgtgcatcaacaattgcatgttcttactataaacgttttgttttggtgg |
25644121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University