View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7743_low_11 (Length: 358)
Name: NF7743_low_11
Description: NF7743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7743_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 130 - 339
Target Start/End: Complemental strand, 44949314 - 44949104
Alignment:
| Q |
130 |
aactactttaactactctaactcccctttatttgatat--ttttatcaatacacacaccttcaagagaaccttgtcctcaaggttgacatttgttatatt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44949314 |
aactactttaactactctaactcccctttatttgatatatttttatcaatacacacaccttcaagagaaccttgtcctcaaggttgacatttgttatatt |
44949215 |
T |
 |
| Q |
228 |
cttcttgagaaaaaaccgaaagggatagtgttactttggctaacatattcatcacaaaaattggactgaacttcaccaacagtgttgttgtttaccttaa |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44949214 |
cttcttgagaaaaaaccgaaagggatagtgttactttggctaacata-tcatcacaaaaattggactgaacttcaccaacagtgttgttgtttaccttaa |
44949116 |
T |
 |
| Q |
328 |
gagatttagttg |
339 |
Q |
| |
|
|||||||||||| |
|
|
| T |
44949115 |
gagatttagttg |
44949104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University