View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7743_low_9 (Length: 385)
Name: NF7743_low_9
Description: NF7743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7743_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 273; Significance: 1e-152; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 98 - 370
Target Start/End: Original strand, 33106927 - 33107199
Alignment:
| Q |
98 |
cgccgttcatttcctcgccgatccgaaaaccgacgaggttttcgctaagcttttccttcaaccgttgaatgatttcaccgttaattttccacggattccg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33106927 |
cgccgttcatttcctcgccgatccgaaaaccgacgaggttttcgctaagcttttccttcaaccgttgaatgatttcaccgttaattttccacggattccg |
33107026 |
T |
|
| Q |
198 |
gtgattgaagctgacgacggtgagaggatttcttcgtttgcgaagattcttactccgtctgatgcgaacaacggtggtggattttctgttccgaggtttt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33107027 |
gtgattgaagctgacgacggtgagaggatttcttcgtttgcgaagattcttactccgtctgatgcgaacaacggtggtggattttctgttccgaggtttt |
33107126 |
T |
|
| Q |
298 |
gtgctgattcgatttttcctccgttggattatagtatggatcctccgttgcagaatctgttgattactgatgt |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33107127 |
gtgctgattcgatttttcctccgttggattatagtatggatcctccgttgcagaatctgttgattactgatgt |
33107199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 19 - 49
Target Start/End: Original strand, 33106848 - 33106878
Alignment:
| Q |
19 |
acatggaccaagctacttcacttccgaacaa |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
33106848 |
acatggaccaagctacttcacttccgaacaa |
33106878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University