View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7745_high_31 (Length: 275)
Name: NF7745_high_31
Description: NF7745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7745_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 15 - 263
Target Start/End: Original strand, 45068887 - 45069135
Alignment:
| Q |
15 |
aaaatgaataaaggattggatgattgattctgttcaatggttatcggttttgtttgtcttttagtttcaactagtataagacatggatattaaggttgct |
114 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45068887 |
aaaatgaataaaggagtggatgattgattctgttcaatggttatcggttttgtttgtcttttagtttcaactagtataagacatggatattaaggttgct |
45068986 |
T |
 |
| Q |
115 |
ttatgacaagaagtagctgtcagtttatgatttccatgagattgttataactttatttaaaggttaatgataaggtttggattgtttttctcgtggaata |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45068987 |
ttatgacaagaagtagctgtcagtttatgatttccatgagattgttataactttatttaaaggttaatgataaggtttggattgtttttctcgtggaata |
45069086 |
T |
 |
| Q |
215 |
ggatgaacaggatagaaaacagtaaaaaagattagtacatttttggttc |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45069087 |
ggatgaacaggatagaaaacagtaaaaaagattagtacatttttggttc |
45069135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University