View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7745_high_36 (Length: 258)
Name: NF7745_high_36
Description: NF7745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7745_high_36 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 3 - 258
Target Start/End: Original strand, 7120412 - 7120667
Alignment:
| Q |
3 |
agttgcacttcgtttggggagtctgagcctcaagattctactcctcagatcatcatcaccctccgaagagttcggagtttcttccgcataatcactggtc |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7120412 |
agttgcacttcgtttggggagtctgagcctcaagattctactccttagatcatcatcaccctccgaagagttcggagtttcttccacataatcactggtc |
7120511 |
T |
|
| Q |
103 |
acagcatctgaagataaaaatcttgctgaacgatgattgtgatgataattattgctgattaaaccggtgtttctgcaaaatggaagaatttataaatgcg |
202 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7120512 |
acagcatttgaagtgaaaaatcttgctgaacgatgattgtgatgataattattgctgattaaaccggtgtttctgcaaaatggaagaatttataaatgcg |
7120611 |
T |
|
| Q |
203 |
cgataatttgaatctgattggatgctcagaaaattggagaaagttgggaacttgaa |
258 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7120612 |
cgataatttgaatctgattggatgctgagaaaattggagaaagttgggaacttgaa |
7120667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University