View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7745_high_46 (Length: 205)
Name: NF7745_high_46
Description: NF7745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7745_high_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 13 - 132
Target Start/End: Complemental strand, 31171449 - 31171330
Alignment:
| Q |
13 |
tggtgttggaatcaaaaggattgccttgtgacggtgatttagaggtgttttttgcagtgttgatttcagggggctgtgattatctctgttctttacatgc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31171449 |
tggtgttggaatcaaaaggattgccttgtgacggtgatttagaggtgttttttgcagtgttgatttcagggggctgtggttatctctgttctttacatgc |
31171350 |
T |
 |
| Q |
113 |
ttggttgtccacttgtcatg |
132 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
31171349 |
ttggttgtccacgtgtcatg |
31171330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University