View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7745_low_18 (Length: 391)
Name: NF7745_low_18
Description: NF7745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7745_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 18 - 378
Target Start/End: Original strand, 42867388 - 42867749
Alignment:
| Q |
18 |
tcaagtaccctagtttctttcgactacgaaacaataattcatatgcaagata-gnnnnnnngtagttcttctgtgatcatgtccctctagaagtggacac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42867388 |
tcaagtaccctagtttctttcgactacgaaacaataattcatatgcaagataagtttttttgtagttcttctgtgatcatgtccctctagaagtggacac |
42867487 |
T |
 |
| Q |
117 |
gtgtggaaatgctatgcatacatattctttttcactctagaagtggacagaaattttgttttatctttttctgaatttaatggttatttcttgacccaat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42867488 |
gtgtggaaatgctatgcatacatattctttttcactctagaagtggacagaaattttgttttatctttttctgaatttaatggttatttcttgacccaat |
42867587 |
T |
 |
| Q |
217 |
tttgttgctgcctttctttgttttttgatgcacagcggtatcatgcttacttcatggaggagatcgactcatggatgattatatctgcaggttcacttct |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42867588 |
tttgttgctgcctttctttgttttttgatgcacagcggtatcatgcttacttcatggaggagatcgactcatggatgattatatctgcaggttcacttct |
42867687 |
T |
 |
| Q |
317 |
ctttttattgaggatcttgtacatatgtttcagcttcctatgttatatcatggcctgtttct |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42867688 |
ctttttattgaggatcttgtacatatgtttcagcttcctatgttatatcatggcctgtttct |
42867749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University