View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7745_low_26 (Length: 351)
Name: NF7745_low_26
Description: NF7745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7745_low_26 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 17 - 351
Target Start/End: Original strand, 55184055 - 55184389
Alignment:
| Q |
17 |
atgctcttggtgttgggatgggctctatgtacagagacagcttctgttatcactccactcttggtgttgtgacactgccgaagcagaagaagctcataat |
116 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55184055 |
atgctcttggtgttgggatggactctatgtacagagacagcttctgttatcacttcactcttggtgttgtgacactgccgaagcagaagaagctcataat |
55184154 |
T |
 |
| Q |
117 |
ggtggtattagtattaaccaccggtctcaagtggaaggaatttgaacatacccctcaatcttcttggaatgaaggggttgacagatttctgttactacat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
55184155 |
ggtggtattagtattaaccaccggtctcaagtggaaggaatttgaacatacccctcaatcttcttggaatgaaggggttgacagatttctgttactgtat |
55184254 |
T |
 |
| Q |
217 |
gatttaccaaatgcaatgtggaacatagagtctatgtgaaggcattcaaaattatagatttgttaatgggtgtatgcatacagatgatcaatccatcatc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55184255 |
gatttaccaaatgcaatgtggaacatagagtctatgtgaaggcattcaaaattatagatttgttaatgggtgtatgcatacagatgatcaatccatcatc |
55184354 |
T |
 |
| Q |
317 |
aaggnnnnnnntagaaattatgtattggaaattgt |
351 |
Q |
| |
|
|||| |||||||||||||||||||||||| |
|
|
| T |
55184355 |
aaggaaaaaaatagaaattatgtattggaaattgt |
55184389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University