View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7745_low_32 (Length: 298)
Name: NF7745_low_32
Description: NF7745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7745_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 45362404 - 45362683
Alignment:
| Q |
1 |
tactctttgcaatcatcaaggaatccaactccaagagggtctagtttcaaccacacagatttacattccatgatgggtggtagtcgtaattctaactttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45362404 |
tactctttgcaatcatcaaggaatccaactccaagagggtctagtttcaaccacacagatttacattccatgatgggtggtagtcgtaattctaactttg |
45362503 |
T |
 |
| Q |
101 |
gtgcttctgatttgaaaggaacaccaccgaggacttgtaattatgataattcagtgtctacgacaaaggggaattaccctgcgccaaaccccgaaatgtt |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45362504 |
gtgcttttgatttgaaaggaacaccaccgaggacttgtaattatgataattcaatgtctacgacaaaggggaattaccctgcgccaaaccccgaaatgtt |
45362603 |
T |
 |
| Q |
201 |
ctctccaaaaaacgttgctgctgctaagaaaacgaaggatcttgatatgnnnnnnnggagttcaagtgattcccttgttt |
280 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
45362604 |
ctctccaaaaaacgttgttgctgctaagaaaacggaggatcttcatatgtttttttggagttcaagtgattcccttgttt |
45362683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University