View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7745_low_35 (Length: 291)
Name: NF7745_low_35
Description: NF7745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7745_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 11 - 276
Target Start/End: Original strand, 24317181 - 24317442
Alignment:
| Q |
11 |
aatataatagcattttcaaagaaggtatagataaatggtttcataacaagatgaattatatcttatttttcttctcatcggtggaaacaaacgtgacaat |
110 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24317181 |
aatataataacattttcaatgaaggtatagataaatggtttcataacaagatgaattatatcttatttttcttctcatcggtggaaccaaacgtgacaat |
24317280 |
T |
 |
| Q |
111 |
gtgagttttatataatttgattagatatcttaattaagctcctatagagtttacttgcttgttaagcaacgaagtgcaatgttaagcagcgaagtgcaat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24317281 |
gtgagttttatataatttgattagatatcttaattaagctcctatagagtttacttgcttgttaagcaacgaagtgcaatgttaagcaacgaagtgcaa- |
24317379 |
T |
 |
| Q |
211 |
gtttagagtgattagttataggcaaatgtgtagcagctcaatgcatagaatcacttgcctataaat |
276 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24317380 |
---tagagtgattagttatagacaaatgtgtagcagctcaatgcatagaatcacttgcctataaat |
24317442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University