View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7745_low_43 (Length: 261)
Name: NF7745_low_43
Description: NF7745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7745_low_43 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 7e-98; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 7544844 - 7544620
Alignment:
| Q |
1 |
tctaattttaaaggatgacttcaagctactcaaaaactttccccgacgcggtaatggccggacaagttcccagcaactcttttcaccaccgtcctccgcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7544844 |
tctaattttaaaggatgacttcaagctactcataaactttccccgacgccgtaatggccggacaagttcccagaaactcttttcaccaccgtcctccgcg |
7544745 |
T |
|
| Q |
101 |
gtaaacttcggcaccgacatcgtcaccttccgatcttgcctcgtcttcatatcactcaaatccatttgcaatggaaactttacagtcccaaatataccag |
200 |
Q |
| |
|
|||||||||||||||| ||||| || |||||||||||||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
7544744 |
gtaaacttcggcaccgtcatcgccaacttccgatcttgcctcgtcttcatatcactcagttccatttgcaatggaaacttcaccgtcccaaatataccag |
7544645 |
T |
|
| Q |
201 |
tataactcttcctatctctgctact |
225 |
Q |
| |
|
|||||||||||||||| |||||||| |
|
|
| T |
7544644 |
tataactcttcctatcactgctact |
7544620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 7554622 - 7554398
Alignment:
| Q |
1 |
tctaattttaaaggatgacttcaagctactcaaaaactttccccgacgcggtaatggccggacaagttcccagcaactcttttcaccaccgtcctccgcg |
100 |
Q |
| |
|
||||||| ||||||||||||||||| |||| | |||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
7554622 |
tctaattctaaaggatgacttcaagttacttataaactttccccgacgccgtaatggccggataagttcccagcaactcttttcaccaccgtcctctgcg |
7554523 |
T |
|
| Q |
101 |
gtaaacttcggcaccgacatcgtcaccttccgatcttgcctcgtcttcatatcactcaaatccatttgcaatggaaactttacagtcccaaatataccag |
200 |
Q |
| |
|
|||||||||||||||| ||||| || |||||||||||||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
7554522 |
gtaaacttcggcaccgtcatcgccaacttccgatcttgcctcgtcttcatatcactcagttccatttgcaatggaaacttcaccgtcccaaatataccag |
7554423 |
T |
|
| Q |
201 |
tataactcttcctatctctgctact |
225 |
Q |
| |
|
|||||||||||||||| |||||||| |
|
|
| T |
7554422 |
tataactcttcctatcactgctact |
7554398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 7558957 - 7558881
Alignment:
| Q |
134 |
tcttgcctcgtcttcatatcactcaaatccatttgcaatggaaactttacagtcccaaatataccagtataactctt |
210 |
Q |
| |
|
||||||||| | || ||||||||||| |||||||| || |||||||| || ||||||| ||||| || |||||||| |
|
|
| T |
7558957 |
tcttgcctcattttaatatcactcaactccatttgtaacggaaacttcaccatcccaaacatacctgtgtaactctt |
7558881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 7563088 - 7563012
Alignment:
| Q |
134 |
tcttgcctcgtcttcatatcactcaaatccatttgcaatggaaactttacagtcccaaatataccagtataactctt |
210 |
Q |
| |
|
||||||||| | || ||||||||||| |||||||| || |||||||| || ||||||| ||||| || |||||||| |
|
|
| T |
7563088 |
tcttgcctcattttaatatcactcaactccatttgtaacggaaacttcaccatcccaaacatacctgtgtaactctt |
7563012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University