View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7745_low_46 (Length: 256)
Name: NF7745_low_46
Description: NF7745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7745_low_46 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 57 - 256
Target Start/End: Complemental strand, 29654755 - 29654563
Alignment:
| Q |
57 |
gcctaacatatactcttcttttctttcatttttgacnnnnnnnncctaacatttacttaaatattaaaattatgttatatgttgaactgaagttatattt |
156 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29654755 |
gcctaacatctactcttcttttctttcatttttgacaaaaaaaacctaacatttacttaaatattaaaattatgttgtatgttgaactgaagttatattt |
29654656 |
T |
 |
| Q |
157 |
gacgaatattagaaagaaagnnnnnnnnngtagttatatttgatgaagaattaaaattgcacattattgcaccaccacaatatattatgtacatttgcat |
256 |
Q |
| |
|
||||||||||||||| |||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29654655 |
gacgaatattagaaaaaaagaa-------gaagttatatttgatgaagaattaaaattgcacattattgcaccaccacaatatattatgtacatttgcat |
29654563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University