View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7745_low_50 (Length: 233)
Name: NF7745_low_50
Description: NF7745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7745_low_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 17 - 226
Target Start/End: Complemental strand, 40300995 - 40300786
Alignment:
| Q |
17 |
agaaagtgtgaaccttatgtgttgttttgtttccctaataaataggtccagagtcaccatgttttagttgttttgttacctctttatattatcattaaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40300995 |
agaaagtgtgaaccttatgtgttgttttgtttccctaataaataggtccagagtcaccatgttttagttgttttggtacctctttatattatcattaaaa |
40300896 |
T |
 |
| Q |
117 |
ttgtcatgagtttgaacactccttgtatttctttaattaaatctatcttgttcttgcatgtacaaggaatcgatatcatgcgtcgattttgagatatgat |
216 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40300895 |
ttgtcatgagtttgaatactccttgtatttctttaattaaatctatcttgttcttgcatgtacaaggaatcgatatcatgcgtcgattttgagatatgat |
40300796 |
T |
 |
| Q |
217 |
gtccatctca |
226 |
Q |
| |
|
| ||||||| |
|
|
| T |
40300795 |
ggacatctca |
40300786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University