View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7745_low_51 (Length: 231)
Name: NF7745_low_51
Description: NF7745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7745_low_51 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 40418893 - 40418682
Alignment:
| Q |
1 |
aaggattaacatcatagtgcatctttgtcataaaaggaaaaaactgcaatatgcacctccttcaacagcagttccatgtgtctgcatattaggtttgtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
40418893 |
aaggattaacatcatagtgcatctttttcataaaaggaaaaaactgcaatatgcacctccttcaacaacagttccacatgtctacatattaggtttgtgg |
40418794 |
T |
 |
| Q |
101 |
acgtctgtggccaacttttaccttacatggctcaaactgcaacacgattacgagctacttcaacgcactagaacctcttcacaatgatgcgtctgaagta |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40418793 |
acgtctgtggccaacttttaccctacatggctcaaactgcaatacgattacgaactacttcaacgcactagaacctcttcacaatgatgcgtctgaagta |
40418694 |
T |
 |
| Q |
201 |
tttcgatagtaa |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
40418693 |
tttcgatagtaa |
40418682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University