View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7745_low_52 (Length: 230)
Name: NF7745_low_52
Description: NF7745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7745_low_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 13140195 - 13139985
Alignment:
| Q |
1 |
ttatgactcaaggcaattttcgaaagaaatcatgggaatgagtgttttggccatgactgtaattgtgatctgtttgccagaaccaaggggtctttctgtg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13140195 |
ttatgactcaaggcatttttcgaaagaaatcatgggaatgagtgttttggccatgattgtaattgtgatctgtttgccagaaccaaggggtctttctgtg |
13140096 |
T |
 |
| Q |
101 |
gaaaccttcacgaacaatcgttgttttttgatggtttttctgcttctcatcgctgctctttccacacctccggatatctgatgccaaatcgtcgcctgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13140095 |
gaaaccttcacgaacaatcgttgttttttgatggtttttccgcttctcaccgctgctctttccacacctccggatatctgatgccaaatcgtcgcatgtt |
13139996 |
T |
 |
| Q |
201 |
tcctaatttct |
211 |
Q |
| |
|
|||| |||||| |
|
|
| T |
13139995 |
tccttatttct |
13139985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University