View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7745_low_55 (Length: 215)
Name: NF7745_low_55
Description: NF7745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7745_low_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 12 - 197
Target Start/End: Original strand, 21546147 - 21546333
Alignment:
| Q |
12 |
gagtttggagttcatgtaactttcatcaacctagtgaaaatcaatagtgaaggaacaatttctcttatcaattgtgacaccaaaacagcatgagacatgc |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
21546147 |
gagtttagagttcatgtaactttcatcaacctagtgaaaatcaatagtgaaggaacaatttctcttatcaattgagacaccaaaacagcatgacacatgc |
21546246 |
T |
|
| Q |
112 |
catttgnnnnnnnnnnnnnnncaattataggaaatcgattgtaaga-caaaggt--tacaataatggccttctacattcactcaataat |
197 |
Q |
| |
|
|||||| ||||||||| |||||||||| |||| ||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
21546247 |
catttg--aaaaaaaaaaaaacaattatagaaaatcgattgcaagatcaaaggttatacaataatggccttccacattcactcaataat |
21546333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 43 - 117
Target Start/End: Complemental strand, 7498637 - 7498563
Alignment:
| Q |
43 |
tagtgaaaatcaatagtgaaggaacaatttctcttatcaattgtgacaccaaaacagcatgagacatgccatttg |
117 |
Q |
| |
|
|||||||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7498637 |
tagtgaaaatgaatagcaaagaaacaatttctcttatcaattgtgacaccaaaacagcatgacacatgccatttg |
7498563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 43 - 117
Target Start/End: Original strand, 37685124 - 37685198
Alignment:
| Q |
43 |
tagtgaaaatcaatagtgaaggaacaatttctcttatcaattgtgacaccaaaacagcatgagacatgccatttg |
117 |
Q |
| |
|
|||||||||| ||||| ||| |||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37685124 |
tagtgaaaatgaatagcaaagaaacaatttcttttatcaattgtgacaccaaaacagcatgacacatgccatttg |
37685198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 67 - 117
Target Start/End: Complemental strand, 46885186 - 46885136
Alignment:
| Q |
67 |
caatttctcttatcaattgtgacaccaaaacagcatgagacatgccatttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
46885186 |
caatttctcttatcaattgtgacaccaaaactacatgacacatgccatttg |
46885136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University