View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7745_low_6 (Length: 592)
Name: NF7745_low_6
Description: NF7745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7745_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 10 - 71
Target Start/End: Original strand, 52816128 - 52816188
Alignment:
| Q |
10 |
taatactttgatgtttgctgcttctaagatgagattcaattaacctcttttttacttccttg |
71 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52816128 |
taatacttttctgcttgctgcttctaagatgagattcaattaacctc-tttttacttccttg |
52816188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 305 - 400
Target Start/End: Complemental strand, 22141160 - 22141066
Alignment:
| Q |
305 |
ttttatttctcatttatcatttagnnnnnnncaaacgtagtatgtgttt-aactcctgcaggtgtgtgatgtgttttaggtggactccataactatg |
400 |
Q |
| |
|
|||||||||||||||||||||| | |||| ||||||||||||| ||||| || |||| |||||||||||||||||||||| | |||||||| |
|
|
| T |
22141160 |
ttttatttctcatttatcattttgtttgtc-caaatgtagtatgtgttttaactcttg-aggtttgtgatgtgttttaggtggacttcgtaactatg |
22141066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University