View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7746_high_17 (Length: 241)
Name: NF7746_high_17
Description: NF7746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7746_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 226
Target Start/End: Original strand, 18284576 - 18284786
Alignment:
| Q |
16 |
atccaaacatatgctaagtgttcgtttgatattgtgtcatgtttctcaaaagcacggtgacttttcacatgacgcagaagcttacatttgtcacttctgg |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18284576 |
atccaaacatatgctaagtgttcttttgatattgtgtcatgtttctcaaaagcacgatgacttttcacatgacgcagaagcttacatttgtcacttctgg |
18284675 |
T |
|
| Q |
116 |
atatcgcgggaaaaaggtcattgggacgcgagattatagtgggaaacgtagaaccaaacatgttatacttgtgttttgatgcatattttctcactctttc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
18284676 |
atatcgcgggaaaaaggtcattgggacgcgagattatagtgggaaacgtggaaccaaacatgttatacgtgtgttttgatgcatgttttctcactctttc |
18284775 |
T |
|
| Q |
216 |
tcacttcccta |
226 |
Q |
| |
|
|||||| |||| |
|
|
| T |
18284776 |
tcactttccta |
18284786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University