View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7746_low_17 (Length: 256)
Name: NF7746_low_17
Description: NF7746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7746_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 45 - 239
Target Start/End: Original strand, 34600525 - 34600725
Alignment:
| Q |
45 |
agtgagaacgaacattgcctgaagttcttattcttactatcgcaagtgaaatgtttaaagcattgatgatgggtgtctacctctgaaatgtcagagcgtc |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34600525 |
agtgagaacgaacattgcctgaagttcttattcttactatcgcaagtgaaatgtttaaagcattgatgatgggtgtctacctctgaaatgtcagagcgtc |
34600624 |
T |
 |
| Q |
145 |
tggtgaatcaagtgtttatacaattatttaagtac------ttgcatccacaggcgcaggtcaaaatttatgaatgcatccctcctttcatttggcttca |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34600625 |
tggtgaatcaagtgtttatacaattatttaagtacacgatattgcatccacaggagcaggtcaaaatttatgaatgcatccctcctttcatttggcttca |
34600724 |
T |
 |
| Q |
239 |
t |
239 |
Q |
| |
|
| |
|
|
| T |
34600725 |
t |
34600725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University