View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7747_low_12 (Length: 287)
Name: NF7747_low_12
Description: NF7747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7747_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 17 - 249
Target Start/End: Complemental strand, 18029730 - 18029503
Alignment:
| Q |
17 |
atatagtagtttaagttgatatttgttgttataggaaatgaaaattaaagtttcaattttggtagatggatgcagatcttataatttatagtagtgttta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18029730 |
atatagtagtttaagttgatatttgttgttataggaaatgaaaattaaagtttcaattttggtagatggatgcagattttataatttatagtagtgttta |
18029631 |
T |
|
| Q |
117 |
tgtacattataataaatgcaacatagagtggtgagatgtatataattgaagattgaacatggttcaaaacctcttttgtaatacataaaataaaatacaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| ||||||| ||||||| |
|
|
| T |
18029630 |
tgtacattataataaatgcaacatagagtggtgagatgtatataattgaagattgaacatatttcatcacctcttttgtattacataa-----aatacaa |
18029536 |
T |
|
| Q |
217 |
cattgtttttgggctttttccctcttttgtacc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
18029535 |
cattgtttttgggctttttccctcttttgtacc |
18029503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 154 - 201
Target Start/End: Complemental strand, 39352990 - 39352943
Alignment:
| Q |
154 |
gtatataattgaagattgaacatggttcaaaacctcttttgtaataca |
201 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
39352990 |
gtatgtaattgaagattaaacatggttcaaaactgcttttgtaataca |
39352943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University