View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7747_low_7 (Length: 344)
Name: NF7747_low_7
Description: NF7747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7747_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 327
Target Start/End: Original strand, 24320342 - 24320667
Alignment:
| Q |
1 |
agatgggttttgaagcggaccatcctgattggtggtcgatggtggtttggtacttaaaaatcacctaaaacatcgattgataatgtttcttaaaagtaga |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
24320342 |
agatgggttttcaagcggaccatcctgattggtggtcgatggtggtttggtacttaaaaatcacctaaaatatcgattgacaatgtttcttaaaagtaga |
24320441 |
T |
 |
| Q |
101 |
agttcacgttt-----ttgatctttatgactgaaacgtcgattcgatagaaatgaggaaaaattaa-gggtaataggtgagtcttatgcacttatattgg |
194 |
Q |
| |
|
||||||||| | ||||||||||||| ||||||||||||| ||| |||||||||||||||||| ||||||||| ||||||||||||||||||||| | |
|
|
| T |
24320442 |
agttcacgtgtccttcttgatctttatgattgaaacgtcgattagatcgaaatgaggaaaaattaatgggtaatagatgagtcttatgcacttatattcg |
24320541 |
T |
 |
| Q |
195 |
tttcctcttaactttgtcaacagtgatcacctctcaactgggaaaactgagaactatgatcttctactttcaaaagataaatatatgtttggtgttaaca |
294 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24320542 |
tttcctcttgactttgtca-------tcacctctcaactgggaaaactgagaactacgatcttctactttcaaaagataaatatatgtttggtgttaaca |
24320634 |
T |
 |
| Q |
295 |
aggtttcagtcgatttttaggtacgagccaagt |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
24320635 |
aggtttcagtcgatttttaggtacgagccaagt |
24320667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University