View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7748_high_5 (Length: 240)
Name: NF7748_high_5
Description: NF7748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7748_high_5 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 17 - 240
Target Start/End: Original strand, 6117173 - 6117396
Alignment:
| Q |
17 |
aacaccacacttcacttccactataatcttcaatggacacaatccttctctttctagtatgcttgctcacctcacactcctcatattccaaaacaaagga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6117173 |
aacaccacacttcacttccactataatctttaatggacacaatccttctctttctaatatgcttgctcatctcacactcctcatattccaaaacaaagga |
6117272 |
T |
|
| Q |
117 |
atataactataaaagtttataatagtggttaaaaaatacgtcttagattcaaacatttcgagttcgaactcagttaatattctaagattaagatcaatgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6117273 |
atataactataaaagtttataatagtggttaaaaaatacgtcttagattcaaacattttaagttcgaactccgttaatattctaagattaagatcaatgt |
6117372 |
T |
|
| Q |
217 |
aaacttataccctttaaaccatga |
240 |
Q |
| |
|
||| |||||||||||||||||||| |
|
|
| T |
6117373 |
aaatttataccctttaaaccatga |
6117396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University