View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7749_high_4 (Length: 245)
Name: NF7749_high_4
Description: NF7749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7749_high_4 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 12 - 245
Target Start/End: Complemental strand, 9662086 - 9661853
Alignment:
| Q |
12 |
attcccctgtcccatacctccacaaaccaaactccaacctctctctgtattcatcttgtttgctacaaattccattccaaaccttcaacaatgtccaaca |
111 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9662086 |
attcccctgtcccatacctccacaaacaaaactccaacctctctctgtattcatcttgtttgctacaaattccattccaaaccttcaacaatgtccaaca |
9661987 |
T |
|
| Q |
112 |
acagcaacaacaacgcatgtgggttgatatcatgcgacaaacttgacagagttgccaactgggtcggcaccaacgtggcttctgctttctttgcttcctt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9661986 |
acagcaacaacaacgcatgtgggttgatatcatgcgacaaacttgacagagttgccaactgggtcggcaccaacgtggcttctgctttctttgcttcctt |
9661887 |
T |
|
| Q |
212 |
ggaacgttgttcttgcctcaaccttaccaccact |
245 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
9661886 |
ggaacgttgttcttgcatcaaccttaccaccact |
9661853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University