View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7749_low_10 (Length: 322)
Name: NF7749_low_10
Description: NF7749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7749_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 313
Target Start/End: Original strand, 37234651 - 37234937
Alignment:
| Q |
18 |
tttctatttatctaaaatttacagccaaattagtctcagacttttaccacnnnnnnnnnnnnnnnnnnnggtggtgggcatatttatttggtggtgacag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37234651 |
tttctatttatctaaaatttacagccaaattagtctcagaattttaccacttttttttgtttt------ggtggtgggcatatttatttggtggtgacag |
37234744 |
T |
|
| Q |
118 |
aattttaccactttactagcaacttaatattatcgtataagctcattttcatcagcttggtccgttagcgggattaccacgatcaactcactcttatttg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
37234745 |
aattttaccactttactagcaacttaatattatcgtaaaagctcattttcatc---ttggtccgttagcgggattaccacgattaactcactcttatctg |
37234841 |
T |
|
| Q |
218 |
acaggccagtgtctaggttagttgggagaaaagaaaaagtaggatttttaaccataagaatgacgacttgtatcatctaaccgacaacaccaaact |
313 |
Q |
| |
|
||||| | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37234842 |
acaggttaatgtctaggttagttgggaggaaagaaaaagtaggatttttaaccataagaatgacgacttgtatcatctaaccgacaacatcaaact |
37234937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 157 - 221
Target Start/End: Complemental strand, 5846489 - 5846425
Alignment:
| Q |
157 |
agctcattttcatcagcttggtccgttagcgggattaccacgatcaactcactcttatttgacag |
221 |
Q |
| |
|
|||||||||||||||| |||||| |||| ||| ||||| ||||||||||| |||||| |||||| |
|
|
| T |
5846489 |
agctcattttcatcagtttggtcatttagtggggttaccgcgatcaactcattcttatctgacag |
5846425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University