View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7749_low_17 (Length: 229)
Name: NF7749_low_17
Description: NF7749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7749_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 13 - 213
Target Start/End: Original strand, 2294771 - 2294973
Alignment:
| Q |
13 |
ataatactctgacatgttttggctcttcttcctacagtaagccaccgtttgactcttctttcaacaaaaatggcaaataatgcatgactcaca--aatcc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2294771 |
ataatactctgacatgttttggctcttcttcctacagtaagccaccgtttgactcttctttcaacaaaaatggcaaataatgcatgactcacacaaatcc |
2294870 |
T |
|
| Q |
111 |
ttataaaagcaagcatggtattggtcctttcagcaccacattaatcaaccaaaaaatggagtttgtcctaaactaccttaacatcactaccatagcacta |
210 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2294871 |
ttataaaagcaagtatggtattggtcctttcagcaccacaataatcaaccaaaaaatggagttagtcctaaactaccttaacatcactaccatagcacta |
2294970 |
T |
|
| Q |
211 |
att |
213 |
Q |
| |
|
||| |
|
|
| T |
2294971 |
att |
2294973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University