View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7749_low_2 (Length: 633)
Name: NF7749_low_2
Description: NF7749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7749_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 7e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 7e-97
Query Start/End: Original strand, 411 - 617
Target Start/End: Complemental strand, 12136826 - 12136619
Alignment:
| Q |
411 |
taattttgcttattatccaaacacaa-aagatgaacaaataaaacgaatatgaaaattttttaaaagtagtatattacaacaaatgcactaagaaccaac |
509 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| || | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12136826 |
taattttgcttattatccaaacacaacaagatgaacaaataaaacgaatataaataatttttaaaagtagtatattacaacaaatgcactaagaaccaac |
12136727 |
T |
 |
| Q |
510 |
aatctgtgggggttgactcaacaatctcaacttctttaacccttagttcaaatcagtgtggtttggtttggtttaacagtttgtttaacatccccagggt |
609 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12136726 |
aatttgtgggggttgactcaacaatctcaacttctttaacccttagctcaaatcagtgtggtttggtttggtttaacagtttgtttaacatccccagggt |
12136627 |
T |
 |
| Q |
610 |
ttagtatc |
617 |
Q |
| |
|
|||||||| |
|
|
| T |
12136626 |
ttagtatc |
12136619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University