View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7749_low_7 (Length: 410)
Name: NF7749_low_7
Description: NF7749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7749_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 30 - 393
Target Start/End: Complemental strand, 38028090 - 38027727
Alignment:
| Q |
30 |
acattagccgtttccattggttctaatatgaacaaaatcaaccttctttggaggataatgtttatgggctttgttgcgtgttcctagagggactaaacaa |
129 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38028090 |
acattggccgtttccattggttctaatatgaacaaaatcaaccttctttggaggataatgtttatgggctttgttgcgtgttcctagagggactaaacaa |
38027991 |
T |
 |
| Q |
130 |
taaaggatgacaatgctgctttgttttcaaattatttgctccatggattggtttcaatgactttttagcaacaaagatttttggactgtcttaaatgatg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38027990 |
taaaggatgacaatgctgctttgttttcaaattatttgctccatggattggtttcaatgactttttagcaacaaagatttttggactgtcttaaatgatg |
38027891 |
T |
 |
| Q |
230 |
tatggtttgttagcttgaacatgaggtgtgttgggtatgtcaannnnnnnctgcaaaatcatccttttatgctgcagaatgcatgtagtccattggttgt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38027890 |
tatggtttgttagcttgaacatgaggtgtgttgggtatgtcaatttttttctgcaaaatcatccttttatgctgcagaatgcatgcagtccattggttgt |
38027791 |
T |
 |
| Q |
330 |
taaacagattttatcagaatattttgtttggtagctgtcagtggagattttattactcttatgt |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||||||||| |
|
|
| T |
38027790 |
taaacagattttatcagaatattttgtttggtagccgtcattggagatttgattactcttatgt |
38027727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University