View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7750_high_19 (Length: 434)
Name: NF7750_high_19
Description: NF7750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7750_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 274 - 417
Target Start/End: Complemental strand, 50501838 - 50501695
Alignment:
| Q |
274 |
ttggataaccgttagataagtttatggatggtgttggcttccacttattgagtgcattataaaacaaagtattaggcccacaaattatttgttttcatcc |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50501838 |
ttggataaccgttagataagtttatggatggtgttggcttccacttattgagtgcattataaaacaaagtattaggcccacaaattatttgttttcatcc |
50501739 |
T |
 |
| Q |
374 |
cttgcaatgattattaggtgtaatgtaatgatccaataaacaat |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50501738 |
cttgcaatgattattaggtgtaatgtaatgatccaataaacaat |
50501695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 195 - 256
Target Start/End: Complemental strand, 3244658 - 3244597
Alignment:
| Q |
195 |
gtgtacccacgagtttgttgtgcgccttgcatactctcgacggaaataatattagccgtttc |
256 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
3244658 |
gtgtacccgcgagtttgttgtgcgccttgcatactctcgatgtgaataatattagccgtttc |
3244597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University