View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7750_high_38 (Length: 309)
Name: NF7750_high_38
Description: NF7750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7750_high_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 122 - 295
Target Start/End: Complemental strand, 30472172 - 30471998
Alignment:
| Q |
122 |
tgtgagccaaatcttcaaccaccattgcaaatctccaaacgagatccaaacacttatcttctgctactcgaacgaaa-cccgtccacaaaaaccacaaat |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30472172 |
tgtgagccaaatcttcaaccaccattgcaaatctccaaacgagatccaaacacttatcttccactactcgaacgaaaacccgtccacaaaaaccacaaat |
30472073 |
T |
 |
| Q |
221 |
cgatggatggaggttttatatttaaggatggatgaaggtaattaaattggacatattaggatcaattgagtgatg |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30472072 |
cgatggatggtggttttatatttaaggatggatgaaggtaattaaattggacatattaggatcaattgagtgatg |
30471998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University