View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7750_high_45 (Length: 271)
Name: NF7750_high_45
Description: NF7750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7750_high_45 |
 |  |
|
| [»] scaffold0790 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 2299233 - 2299485
Alignment:
| Q |
1 |
attataaaagctaaaattcatattgttcgccgtgataacttacgcattggtgattttctacattggctcactttggcagtagctcgcggtgacaatttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2299233 |
attataaaagctaaaattcatattgttcgtcgtgataacttacgtattggtaattttctccattggctcactttggcagtagctcgcggtgacaatttat |
2299332 |
T |
 |
| Q |
101 |
gcagtggcgattacctacagttgctcatagtactggtatacttcttgcatttttgtttttaggttgttcatctagcctttgtcgtgcttcactttttctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
2299333 |
gcagtggcgattacctacagttgctcatagtaatggtatacttcttgcatttttgtttttaggttgttcatctggcctttgtcgcgcttcactttttctt |
2299432 |
T |
 |
| Q |
201 |
tggagtaatctggtttagttccgctcagctgtagcaggctttcatgcaacttt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2299433 |
tggagtaatctggtttagttccgctcagctgtagcaggctttcatgcaacttt |
2299485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0790 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0790
Description:
Target: scaffold0790; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 3449 - 3504
Alignment:
| Q |
193 |
tttttctttggagtaatctggtttagttccgctcagctgtagcaggctttcatgca |
248 |
Q |
| |
|
|||| |||||||||||| |||||| |||| |||||||||||| ||||||||||||| |
|
|
| T |
3449 |
ttttgctttggagtaatatggttttgttcagctcagctgtagtaggctttcatgca |
3504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University