View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7750_low_23 (Length: 429)
Name: NF7750_low_23
Description: NF7750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7750_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 246
Target Start/End: Original strand, 34663076 - 34663309
Alignment:
| Q |
18 |
ccatttgcatttttgaacttacctatatatagatactatgacataatgattatattaataaca---gttgcaatnnnnnnntcagtacagag--tggctt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |||||| |
|
|
| T |
34663076 |
ccatttgcatttttgaacttacctatatatagatactatgacataatgattatattaataacaacagttgcaataaaaaaatcagtacagagagtggctt |
34663175 |
T |
|
| Q |
113 |
caattcacactaattggctttagtgaggtaaacgtttaaatatcgttttagtctttataaaatattattttatttttcatccctaaaatttgataagtat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34663176 |
caattcacactaattggctttagtgaggtaaacgtttaaatatcgttttagtctttataaaatattattttatttttcatccctaaaatttgataagtat |
34663275 |
T |
|
| Q |
213 |
catttatcaaatttttaaagagtcttgctatcaa |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34663276 |
catttatcaaatttttaaagagtcttgctatcaa |
34663309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 351 - 423
Target Start/End: Original strand, 34663306 - 34663378
Alignment:
| Q |
351 |
tcaatcataatctaagaagcaactgatgcagacagataacatcgtacaagtagctgttctgttaaacaccaaa |
423 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34663306 |
tcaatcataatctaagaagcaactgatgcagacagataacatcgtacaagtagctgttctgttaaacaccaaa |
34663378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University