View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7750_low_27 (Length: 413)
Name: NF7750_low_27
Description: NF7750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7750_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 16 - 402
Target Start/End: Original strand, 51964427 - 51964813
Alignment:
| Q |
16 |
ataataataagcatgcccccactcaatcgtgtcttgaccggnnnnnnnnnnnnnnnnnnntatgtggtatctagctaagtaaaaccaaaagaacacaagg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51964427 |
ataataataagcatgcccccactcaatcgtgtcttgaccggtgttgttgttgttgttgtttatgtggtagctagctaagtaaaaccaaaagaacacaagg |
51964526 |
T |
|
| Q |
116 |
tctgccaagaatcacaaatgcctagatggtgatggattagacaactgagacacttattgggctccacaactgtgctctctacttaagatcctgttttgat |
215 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51964527 |
tctgccaagaatcacaaaggcctagatagtgatggattagacaactgggacacttattgggctccacaactgtgctctctacttaagatcctgttttgat |
51964626 |
T |
|
| Q |
216 |
gcaaactaccttaattaaatttcccccctctcttatttattttgcacaaagtagctgaaaatttgttgtcaaacagaggaagctaagcttgctgattgag |
315 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51964627 |
gcaaactaccttaattaaatttcccctctctcttatttattttgcacaaagtagctgaaaatttgttgtcaaacagaggaagctaagcttgctgattgag |
51964726 |
T |
|
| Q |
316 |
acggaccatgaaacgctttcaatcttacaatcagttggcctttgtatttatcaacagcctacaacctcgactttaaaccccattcat |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51964727 |
acggaccatgaaacgctttcaatcttacaatcagttggcctttgtatttatcaacagcctacaacctcgactttaaaccccattcat |
51964813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University