View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7750_low_48 (Length: 307)
Name: NF7750_low_48
Description: NF7750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7750_low_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 27601707 - 27601899
Alignment:
| Q |
1 |
ggactcattcagctctcgttttcaatttaaaaatgtaatgaaccgacgaaccaaaccgataacttaataatgtgatgtcttttgcaaatatctaccagcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27601707 |
ggactcattcagctctcgttttcaatttaaaaatgtaatgaaccgacgaaccaaaccgataacttaataatgtgatgtcttttgcaaatatctgccagcc |
27601806 |
T |
|
| Q |
101 |
tagtcccaacaaaacattacaccatannnnnnnnnactctcatttcttactccaagcaccagattagatacaccaatacactttggcatctca |
193 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27601807 |
tagtcccaacaaaatattacaccattttattttttactctcatttcttactccaagcaccagattagatacaccaatacactttggcatctca |
27601899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 231 - 283
Target Start/End: Original strand, 27601898 - 27601950
Alignment:
| Q |
231 |
caacgagagaaatgagtcacaaaattgtagtatgcatgcattgtaatgtgcaa |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27601898 |
caacgagagaaatgagtcacaaaattgtagcatgcatgcattgtaatgtgcaa |
27601950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University