View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7750_low_55 (Length: 271)

Name: NF7750_low_55
Description: NF7750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7750_low_55
NF7750_low_55
[»] chr4 (1 HSPs)
chr4 (1-253)||(2299233-2299485)
[»] scaffold0790 (1 HSPs)
scaffold0790 (193-248)||(3449-3504)


Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 2299233 - 2299485
Alignment:
1 attataaaagctaaaattcatattgttcgccgtgataacttacgcattggtgattttctacattggctcactttggcagtagctcgcggtgacaatttat 100  Q
    ||||||||||||||||||||||||||||| |||||||||||||| |||||| ||||||| ||||||||||||||||||||||||||||||||||||||||    
2299233 attataaaagctaaaattcatattgttcgtcgtgataacttacgtattggtaattttctccattggctcactttggcagtagctcgcggtgacaatttat 2299332  T
101 gcagtggcgattacctacagttgctcatagtactggtatacttcttgcatttttgtttttaggttgttcatctagcctttgtcgtgcttcactttttctt 200  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||    
2299333 gcagtggcgattacctacagttgctcatagtaatggtatacttcttgcatttttgtttttaggttgttcatctggcctttgtcgcgcttcactttttctt 2299432  T
201 tggagtaatctggtttagttccgctcagctgtagcaggctttcatgcaacttt 253  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
2299433 tggagtaatctggtttagttccgctcagctgtagcaggctttcatgcaacttt 2299485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0790 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0790
Description:

Target: scaffold0790; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 3449 - 3504
Alignment:
193 tttttctttggagtaatctggtttagttccgctcagctgtagcaggctttcatgca 248  Q
    |||| |||||||||||| |||||| |||| |||||||||||| |||||||||||||    
3449 ttttgctttggagtaatatggttttgttcagctcagctgtagtaggctttcatgca 3504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University