View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7750_low_56 (Length: 269)
Name: NF7750_low_56
Description: NF7750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7750_low_56 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 37 - 251
Target Start/End: Original strand, 31534266 - 31534483
Alignment:
| Q |
37 |
ttaaaccgctagtgatatagctcaatccagtgtcctttttaaattgacttttactttaaccactttatgtgttacttgcgcgtaattgtgtgcctacatg |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| ||||||||||| |
|
|
| T |
31534266 |
ttaaaccgctagtgatatagctcaatccagtgtcctttttaaattgacttttactttaaccactttatgtgttacttacgcttaattgcgtgcctacatg |
31534365 |
T |
 |
| Q |
137 |
acatgtttgttgatgattat---atagtttgttatcaacttctaaaagagcttaccaatgtagataatgatcgttatttctgattgattgggttggacga |
233 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| | |
|
|
| T |
31534366 |
acatgtttgttgataattatcagatagtttgttatcaacttctaaaagagcttaccagtgtagataatgatcgttatttttgattgattgggttggacaa |
31534465 |
T |
 |
| Q |
234 |
tcgttgcaaccaggtctt |
251 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
31534466 |
tcgtttcaaccaggtctt |
31534483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University