View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7750_low_61 (Length: 254)
Name: NF7750_low_61
Description: NF7750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7750_low_61 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 12 - 238
Target Start/End: Complemental strand, 4643774 - 4643548
Alignment:
| Q |
12 |
aagaatatatattatgttcaaattggaaaaattaaggatatgccacaaactacacagataatatattatgttcaagaaacgtttactacatacgcattgt |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4643774 |
aagaaaatatattatgttcaaattggaaaaattaaggatatgccacaaactacacagataatatattatgttcaagaaacgtttactacatacgcattgt |
4643675 |
T |
|
| Q |
112 |
ttaagaacacaaagcatgcagatacatcatgttgggaatattgaccagttatacaaaacttgggaagtaatttgtatttatgtaccatgctagtgccata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4643674 |
ttaagaacacaaagcatgcagatacatcatgttgggaatattgaccagttatacaaaacttgggaagtaatttgtatttatgtaccatgctagtgccata |
4643575 |
T |
|
| Q |
212 |
gataacaacttcatgagcatgtgtatg |
238 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
4643574 |
gataacaacttcatgagcatgtgtatg |
4643548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University